| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.093624 |
| Chromosome: | chromosome 1 |
| Location: | 4981538 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g034451 | (1 of 1) K14012 - UBX domain-containing protein 1 (SHP1, UBX1, NSFL1C) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACGCTCACCTCTTCTCACCACCAGCATAGT |
| Internal bar code: | TATTTGATCTCGCAGCTAATAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 7 |
| LEAP-Seq percent confirming: | 99.8647 |
| LEAP-Seq n confirming: | 1476 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCGGTGTCATGGTACTGGAA |
| Suggested primer 2: | CCCTAACCTCCTCTTCCACC |