| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.093834 |
| Chromosome: | chromosome 16 |
| Location: | 4579657 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g688000 | MCP2,MITC2 | (1 of 4) K15111 - solute carrier family 25 (mitochondrial S-adenosylmethionine transporter), member 26 (SLC25A26); Mitochondrial substrate carrier protein | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GAATGTAACCCCCTCCCCTCTCAGCCGAGC |
| Internal bar code: | GTCGTTTTCGCTAGAGTGTAGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 257 |
| LEAP-Seq percent confirming: | 89.2476 |
| LEAP-Seq n confirming: | 3013 |
| LEAP-Seq n nonconfirming: | 363 |
| LEAP-Seq n unique pos: | 13 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATGCTCTTATCCACATCGCC |
| Suggested primer 2: | GACAGACTCGTAGACCCCCA |