| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.093911 |
| Chromosome: | chromosome 14 |
| Location: | 3097588 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre14.g628650 | MME4 | NADP-dependent malic enzyme 4; (1 of 5) 1.1.1.40 - Malate dehydrogenase (oxaloacetate-decarboxylating) (NADP(+)) / Pyruvic-malic carboxylase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGTGTGCCCGACTGAGTCGCACGCACGTCC |
| Internal bar code: | CTGGCCTCGGACCGCTCCGACG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 325 |
| LEAP-Seq percent confirming: | 74.5285 |
| LEAP-Seq n confirming: | 7587 |
| LEAP-Seq n nonconfirming: | 2593 |
| LEAP-Seq n unique pos: | 23 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTGTAGCACCAGCACCATTG |
| Suggested primer 2: | TGGCTAGGAAGTAAGGCGAA |