Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.093948 |
Chromosome: | chromosome 12 |
Location: | 6207928 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g536600 | FAP78 | Flagellar Associated Protein 78; (1 of 7) PTHR11584:SF381 - PROTEIN PQN-80, ISOFORM B | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCGGCTCTGGGTTTGGTGGCGTAGCCCGGT |
Internal bar code: | AAGGCAATCGGTGTTCGGATCC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 520 |
LEAP-Seq percent confirming: | 98.4243 |
LEAP-Seq n confirming: | 4310 |
LEAP-Seq n nonconfirming: | 69 |
LEAP-Seq n unique pos: | 27 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AGTTGGCCATCAACAAGGAC |
Suggested primer 2: | CCTGTATGGGGTCCATCATC |