Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.093971 |
Chromosome: | scaffold 19 |
Location: | 79070 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre19.g750597 | CDPK2 | Calcium/calmodulin-dependent protein kinase; (1 of 2) PF00069//PF13499 - Protein kinase domain (Pkinase) // EF-hand domain pair (EF-hand_7) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTACGAAGCCTCGCCCACGCCGGTTTCACA |
Internal bar code: | TATAGGTCGGCGACATTGAGCA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 679 |
LEAP-Seq percent confirming: | 97.816 |
LEAP-Seq n confirming: | 1478 |
LEAP-Seq n nonconfirming: | 33 |
LEAP-Seq n unique pos: | 12 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GGTGGAGGTACCGTTTCAGA |
Suggested primer 2: | GATTCGGGGGAGAGAGATTC |