Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.094112 |
Chromosome: | chromosome 1 |
Location: | 2005478 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre01.g010832 | (1 of 1) PTHR12411:SF389 - CATHEPSIN L1 | 5'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCCGCCTGATGCACGACATGACTGTCCATA |
Internal bar code: | CGACCCTGTGCAGGTATTGGCC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 770 |
LEAP-Seq percent confirming: | 98.8729 |
LEAP-Seq n confirming: | 3509 |
LEAP-Seq n nonconfirming: | 40 |
LEAP-Seq n unique pos: | 20 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GCATTCAACAGCTCCACTGA |
Suggested primer 2: | GGACCAACTTGCACTCCCTA |