| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.094237 |
| Chromosome: | chromosome 12 |
| Location: | 2891711 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g502000 | FAP253 | Flagellar Associated Protein 253; (1 of 1) PTHR21074//PTHR21074:SF0 - UNCHARACTERIZED // IQ AND UBIQUITIN-LIKE DOMAIN-CONTAINING PROTEIN | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGTCGTGTGGGCACGCGGTGGGGCAGTAGG |
| Internal bar code: | GCCGTGTTACAATAGGCACGTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 711 |
| LEAP-Seq percent confirming: | 97.9295 |
| LEAP-Seq n confirming: | 5723 |
| LEAP-Seq n nonconfirming: | 121 |
| LEAP-Seq n unique pos: | 12 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTTGGGTAACAGGCTGCATT |
| Suggested primer 2: | CAAGTGGACGGTCAAGGAGT |