| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.094338 |
| Chromosome: | chromosome 13 |
| Location: | 1277822 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g570851 | PSB34 | PSII assembly protein; (1 of 1) PTHR35753//PTHR35753:SF1 - FAMILY NOT NAMED // PROLINE-RICH FAMILY PROTEIN | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTGTGTTCATACGTCCACGGGCCGTGAGGC |
| Internal bar code: | CGTGTCGAATCTGTGTGCTCCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 223 |
| LEAP-Seq percent confirming: | 97.6723 |
| LEAP-Seq n confirming: | 2098 |
| LEAP-Seq n nonconfirming: | 50 |
| LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGCTCGTCAACTCGTGAATC |
| Suggested primer 2: | GACACTGAGGACTTCTCCGC |