| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.094397 |
| Chromosome: | chromosome 9 |
| Location: | 124047 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g386700 | kinesin-13,KIN13-1,CrKin13,KIN13A | Kinesin motor protein 13; (1 of 1) K10393 - kinesin family member 2/24 (KIF2_24, MCAK) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AACCGTCAGACGCGGCTGGAGGGCGCGGAA |
| Internal bar code: | GGTCTTTGGGATTCGGGCAAAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 388 |
| LEAP-Seq percent confirming: | 90.1884 |
| LEAP-Seq n confirming: | 3925 |
| LEAP-Seq n nonconfirming: | 427 |
| LEAP-Seq n unique pos: | 12 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGGATCTACTACTGAGCGCC |
| Suggested primer 2: | CAGCTTGAGGGAGAAATTCG |