Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.094443 |
Chromosome: | chromosome 10 |
Location: | 3146488 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre10.g441850 | (1 of 587) 2.7.11.1 - Non-specific serine/threonine protein kinase / Threonine-specific protein kinase | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTTAAATGGCAGGAGACAGAGCCACTCATG |
Internal bar code: | AACGGTTCGAAGGCGGCAACA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 290 |
LEAP-Seq percent confirming: | 92.7545 |
LEAP-Seq n confirming: | 1549 |
LEAP-Seq n nonconfirming: | 121 |
LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TGTGCGAAGGTAAATGTCCA |
Suggested primer 2: | TTCCTGCCTCGTTTTCACTT |