Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.094620 |
Chromosome: | chromosome 3 |
Location: | 4062238 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre03.g172550 | PRM1,PRMT1 | (1 of 2) K11434 - protein arginine N-methyltransferase 1 (PRMT1); Protein-/Histone-arginine N-methyltransferase | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCGGGCGAGTGAGATGTAGACGAGCCACTG |
Internal bar code: | GTCGCCCCGGTGGTAAATAATC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 615 |
LEAP-Seq percent confirming: | 99.6133 |
LEAP-Seq n confirming: | 3349 |
LEAP-Seq n nonconfirming: | 13 |
LEAP-Seq n unique pos: | 17 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CAGCTCATGTTGAAGCCGTA |
Suggested primer 2: | AACAGCTATGGACACTGGGG |