| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.094642 |
| Chromosome: | chromosome 2 |
| Location: | 1135996 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g081500 | UAA2 | UDP-galactose transporter; (1 of 1) K15277 - solute carrier family 35 (adenosine 3'-phospho 5'-phosphosulfate transporter), member B3 (SLC35B3, PAPST2) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTGCGTATGCGGGCAGGGTTGGGACCTTCT |
| Internal bar code: | GGGTTAGGGTGGTGGCGTCTGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 158 |
| LEAP-Seq percent confirming: | 98.0969 |
| LEAP-Seq n confirming: | 567 |
| LEAP-Seq n nonconfirming: | 11 |
| LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACAGGATTAGGCACACCTGC |
| Suggested primer 2: | TTTGGTTTACTTTGGGCTGG |