| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.094682 |
| Chromosome: | chromosome 16 |
| Location: | 6562501 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g672350 | (1 of 1) IPR001357//IPR001841 - BRCT domain // Zinc finger, RING-type | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CACCAGCACCACCACCGGCGGGATCGAGAT |
| Internal bar code: | AGCGCTACAATGGACGCGAACA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 194 |
| LEAP-Seq percent confirming: | 52.1127 |
| LEAP-Seq n confirming: | 296 |
| LEAP-Seq n nonconfirming: | 272 |
| LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTGCTAGCACATCGGTTCAG |
| Suggested primer 2: | ACGGTGCGTGTGTGTAATGT |