| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.094712 |
| Chromosome: | chromosome 16 |
| Location: | 3086785 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g665450 | RYR1,FAP48 | Ryanodine-inositol 1%252C4%252C5-triphosphate receptor Ca2+ channel; (1 of 1) K04958 - inositol 1,4,5-triphosphate receptor type 1 (ITPR1) | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGTTTGCGAACCCGGGTGGCAGGTCTGAAG |
| Internal bar code: | CGGGTCGTCCAACTTGAGTTGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 738 |
| LEAP-Seq percent confirming: | 99.3376 |
| LEAP-Seq n confirming: | 4499 |
| LEAP-Seq n nonconfirming: | 30 |
| LEAP-Seq n unique pos: | 12 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGTCTCATTCGCAAGTTTCA |
| Suggested primer 2: | CGATAGCCCCACACAACTTT |