Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.094767 |
Chromosome: | chromosome 16 |
Location: | 2038522 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre16.g657000 | (1 of 1) K03134 - transcription initiation factor TFIID subunit 10 (TAF10) | 5'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TATTGCAAGGAACTGTAAAGGAGACGTAGT |
Internal bar code: | GACGTTTACAGACAATCCTTTC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 330 |
LEAP-Seq percent confirming: | 89.7569 |
LEAP-Seq n confirming: | 3286 |
LEAP-Seq n nonconfirming: | 375 |
LEAP-Seq n unique pos: | 11 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CCTTCTCCGTGCCCTATGTA |
Suggested primer 2: | GCTGGAGAGTAAATGCCTGC |