| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.094778 |
| Chromosome: | chromosome 2 |
| Location: | 3775823 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g095450 | FKB16F,FKB9,FKB16-6 | Peptidyl-prolyl cis-trans isomerase, FKBP-type; (1 of 1) PTHR10516:SF145 - PEPTIDYL-PROLYL CIS-TRANS ISOMERASE FKBP42 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCACCTTGCCTTCGCACTCCGCCTCCCTCC |
| Internal bar code: | GAAGCAGGCGTACGTAATGTGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 199 |
| LEAP-Seq percent confirming: | 38.8171 |
| LEAP-Seq n confirming: | 781 |
| LEAP-Seq n nonconfirming: | 1231 |
| LEAP-Seq n unique pos: | 9 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GAAGCAATGCGTGTCTGTGT |
| Suggested primer 2: | AACGAAAGCAAGCTAACCGA |