| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.094826 |
| Chromosome: | chromosome 2 |
| Location: | 2377464 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g091050 | ALAD1,PBGS,HEM2,ALAD | (1 of 1) 4.2.1.24 - Porphobilinogen synthase / Delta-aminolevulinic acid dehydratase; Delta-aminolevulinic acid dehydratase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGGGAGGAGTACGAGGCCGGGGAGTGGCTG |
| Internal bar code: | GGGCCAAGCACGGTGCTAGGAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 439 |
| LEAP-Seq percent confirming: | 98.3333 |
| LEAP-Seq n confirming: | 2478 |
| LEAP-Seq n nonconfirming: | 42 |
| LEAP-Seq n unique pos: | 14 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACCGCGAAGATCTAGGGATT |
| Suggested primer 2: | ACTCGATGGTCTCGTCGTTC |