| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.094827 |
| Chromosome: | chromosome 7 |
| Location: | 2059893 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g325812 | MAW1,ZYS2 | Membrane-associated hydroxyproline-rich glycoprotein 1; (1 of 80) IPR003882 - Pistil-specific extensin-like protein | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGCCGTCGCTGCCTCCCTTTCCTCCTGGCC |
| Internal bar code: | GGGTTTGCTAAGTGGAGGGTGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 219 |
| LEAP-Seq percent confirming: | 34.1911 |
| LEAP-Seq n confirming: | 1063 |
| LEAP-Seq n nonconfirming: | 2046 |
| LEAP-Seq n unique pos: | 12 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AACATCCCCATCTCCACCTA |
| Suggested primer 2: | CACACACAAAGTGCCGTACC |