| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.094846 |
| Chromosome: | chromosome 17 |
| Location: | 6300916 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g742700 | CGLD30,HLM32 | (1 of 1) PTHR22884:SF343 - PROTEIN MET-1, ISOFORM A; SET domain containing protein, putative histone methyltransferase | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCTTCACCTTGTCCAGCGTGATCACGATC |
| Internal bar code: | TTTGTTGGTCCGGCGGTTGGAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 181 |
| LEAP-Seq percent confirming: | 52.5154 |
| LEAP-Seq n confirming: | 595 |
| LEAP-Seq n nonconfirming: | 538 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GACCACATTGATGATGCTCG |
| Suggested primer 2: | GCACCGATATCGTCACAATG |