Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.094861 |
Chromosome: | chromosome 17 |
Location: | 1732465 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre17.g708950 | (1 of 2) 3.2.1.58 - Glucan 1,3-beta-glucosidase / Exo-1,3-beta-glucosidase | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGGGTGATAAGTAGCTGTCAGTAAGTGCAG |
Internal bar code: | GTCAGGGACCTGGCAGGGACT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 0 |
LEAP-Seq percent confirming: | 0.490196 |
LEAP-Seq n confirming: | 2 |
LEAP-Seq n nonconfirming: | 406 |
LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TTATCATGAGGGACGCATCA |
Suggested primer 2: | AGGTCATTGGGAAGAACGTG |