| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.094996 |
| Chromosome: | chromosome 6 |
| Location: | 6270119 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g291200 | Histone H4 acetyltransferase, NuA4 complex-related; (1 of 2) K11344 - chromatin modification-related protein EAF6 (EAF6) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AACCAAGGAGGCACTGATTCCACCCTGTCT |
| Internal bar code: | TCCGGCACTCTCTGCGGCACGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 509 |
| LEAP-Seq percent confirming: | 91.716 |
| LEAP-Seq n confirming: | 1705 |
| LEAP-Seq n nonconfirming: | 154 |
| LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CATCTTCGGAAGCAAGAAGG |
| Suggested primer 2: | CTAAGACTGAGGCGTGGAGG |