| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.095019 |
| Chromosome: | chromosome 16 |
| Location: | 3631895 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g685573 | FAP214 | Flagellar Associated Protein 214; (1 of 3) 3.1.1.4 - Phospholipase A(2) / Phospholipase A2 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGAGTTGCAGTACTTGTTTTGGGTAGGTGG |
| Internal bar code: | CGCTTATAGTAAAAGGGAGGGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 631 |
| LEAP-Seq percent confirming: | 99.0957 |
| LEAP-Seq n confirming: | 1863 |
| LEAP-Seq n nonconfirming: | 17 |
| LEAP-Seq n unique pos: | 30 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACACCAAGGTGAGTCAAGGG |
| Suggested primer 2: | TGTTGTGGGCATATGGAGAA |