| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.095020 |
| Chromosome: | chromosome 12 |
| Location: | 8316822 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g549750 | FAP4,CK1,CSK1 | Flagellar Associated Protein 4; (1 of 2) K02218 - casein kinase 1 (CSNK1, CK1) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGACATTGCTGCCGATGCCGGCGGAGTGCG |
| Internal bar code: | GTTGAGGAGTATGATAATACGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 593 |
| LEAP-Seq percent confirming: | 99.6651 |
| LEAP-Seq n confirming: | 10715 |
| LEAP-Seq n nonconfirming: | 36 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCCGTCCTAGTGGACGTTTA |
| Suggested primer 2: | GGTTCGACTTCTAAGCACGC |