| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.095040 |
| Chromosome: | chromosome 12 |
| Location: | 136243 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g484350 | CKIN beta-gamma,SNRKBG1 | regulatory subunit beta-gamma of snRK1 complex in Chlamydomonas; (1 of 1) K07200 - 5'-AMP-activated protein kinase, regulatory gamma subunit (PRKAG) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACTAGGATGCCGGCGGCCGTGAGGAGGTGT |
| Internal bar code: | AGGGGTTATCCGAAGTCCTGCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 920 |
| LEAP-Seq percent confirming: | 99.8188 |
| LEAP-Seq n confirming: | 6061 |
| LEAP-Seq n nonconfirming: | 11 |
| LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTCATTGTTAGCAGTCGCCA |
| Suggested primer 2: | GGCGCAGTACCTGTTCTTGT |