| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.095080 |
| Chromosome: | chromosome 9 |
| Location: | 7571708 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g414416 | CYCD4 | D-type cyclin; (1 of 1) IPR006671//IPR013763//IPR027417 - Cyclin, N-terminal // Cyclin-like // P-loop containing nucleoside triphosphate hydrolase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTTCCGGGGAGCCGGCAGGGTACGTGTCGC |
| Internal bar code: | GCTTTGTGGTGGTTCATAGCCT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1051 |
| LEAP-Seq percent confirming: | 99.4475 |
| LEAP-Seq n confirming: | 360 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATGGAGAGCGACTGTGAGGT |
| Suggested primer 2: | CAGTGCAGTTGCCAAAAAGA |