| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.095097 |
| Chromosome: | chromosome 6 |
| Location: | 6784228 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g294850 | UBC10 | Ubiquitin-conjugating enzyme E2; (1 of 1) PTHR24067:SF142 - UBIQUITIN-CONJUGATING ENZYME E2 3 | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GAAGGCAAGAAGAAAGTTTGGGTCTAGGAT |
| Internal bar code: | CATAGCTTTTTCCATCGGGGTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 583 |
| LEAP-Seq percent confirming: | 98.7402 |
| LEAP-Seq n confirming: | 1646 |
| LEAP-Seq n nonconfirming: | 21 |
| LEAP-Seq n unique pos: | 15 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCAACGTCGTAGATGGGACT |
| Suggested primer 2: | CGTCTCGAGCAACTTTGTGA |