| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.095139 |
| Chromosome: | chromosome 17 |
| Location: | 1617870 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g707950 | HEP2 | Hsp70 escorting protein 2, chloroplast; (1 of 1) PTHR20922//PTHR20922:SF15 - UNCHARACTERIZED // A_TM021B04.14 PROTEIN | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GAAGCATTCATGATCTGTTGCATATTGGAA |
| Internal bar code: | GTAGCAAGCGCTTACTCGAGGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 647 |
| LEAP-Seq percent confirming: | 99.0375 |
| LEAP-Seq n confirming: | 2881 |
| LEAP-Seq n nonconfirming: | 28 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCGTGAGTACCTGCTGACAA |
| Suggested primer 2: | CCAGCCCAAACTAAACCAAA |