Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.095139 |
Chromosome: | chromosome 17 |
Location: | 1617870 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre17.g707950 | HEP2 | Hsp70 escorting protein 2, chloroplast; (1 of 1) PTHR20922//PTHR20922:SF15 - UNCHARACTERIZED // A_TM021B04.14 PROTEIN | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GAAGCATTCATGATCTGTTGCATATTGGAA |
Internal bar code: | GTAGCAAGCGCTTACTCGAGGA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 647 |
LEAP-Seq percent confirming: | 99.0375 |
LEAP-Seq n confirming: | 2881 |
LEAP-Seq n nonconfirming: | 28 |
LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CCGTGAGTACCTGCTGACAA |
Suggested primer 2: | CCAGCCCAAACTAAACCAAA |