| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.095142 |
| Chromosome: | chromosome 3 |
| Location: | 7239472 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g207650 | Putative Cu chaperone; (1 of 4) 3.6.3.4//3.6.3.54 - Cu(2+)-exporting ATPase // Cu(+) exporting ATPase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGTAAGGCCGTGAAGAAGTTACCAAACTGC |
| Internal bar code: | TAGTACGTTGTGTACACTTGTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 0 |
| LEAP-Seq percent confirming: | 38.8206 |
| LEAP-Seq n confirming: | 158 |
| LEAP-Seq n nonconfirming: | 249 |
| LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTGCCTTACCACTGTCCCAT |
| Suggested primer 2: | AGGATGAATACGACGATGGC |