| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.095146 |
| Chromosome: | chromosome 9 |
| Location: | 1614288 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g397350 | RAD3A,XPD3 | (1 of 1) K15362 - fanconi anemia group J protein (BRIP1, BACH1, FANCJ); RAD3/XP-D family DNA-binding helicase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CACTGCAATGGAATGGCGTCGGTACGCCCC |
| Internal bar code: | TGGTAGGGCTCCGGATGGTCTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 687 |
| LEAP-Seq percent confirming: | 99.8071 |
| LEAP-Seq n confirming: | 1552 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACGACATCGAGGAGCTGTCT |
| Suggested primer 2: | GGTGGGCAGAGGTGTAGGTA |