Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.095253 |
Chromosome: | chromosome 7 |
Location: | 2081582 |
Confidence (%): | 58 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre07.g326050 | KIL8 | Putative kinesin-like motor protein; (1 of 2) PTHR13140//PTHR13140:SF410 - MYOSIN // SUBFAMILY NOT NAMED | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACAACCCCCCCGTCACCAATCCACAGTCCT |
Internal bar code: | CACTCAAAAACATGGCAACCTC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 167 |
LEAP-Seq percent confirming: | 96.5517 |
LEAP-Seq n confirming: | 28 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CTTACACCGGCCTCAGCTAC |
Suggested primer 2: | TGCTTGAGGCGTAATCTCCT |