Insertion junction: LMJ.RY0402.095280_4

Overview

Insertion cassette:CIB1
Side of cassette:5'
Strand:-
Strain:LMJ.RY0402.095280
Chromosome:chromosome_10
Location:1636989
Confidence (%):58
Locus disrupted Locus common name Defline Orientation Feature
Cre10.g429750 antisense CDS

Insertion site details

Flanking sequence (orientation from cassette outwards):GGGATATCGCCTGACCTCGCCTTTTCATAC
Internal bar code:GTGGGCCCGTGTTTCCCCCTGC

Confirmation - LEAP-Seq

LEAP-Seq distance:144
LEAP-Seq percent confirming:4.44444
LEAP-Seq n confirming:2
LEAP-Seq n nonconfirming:43
LEAP-Seq n unique pos:2

Suggested primers for confirmation by PCR

Suggested primer 1:CGTTGGAACATTGGAGGAGT
Suggested primer 2:CGGCAGTCATCTTCTTCACA