| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.095305 |
| Chromosome: | chromosome 16 |
| Location: | 5624879 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g679650 | (1 of 1) PTHR19961:SF18 - FI19014P1 | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGAGAACCTGGCCTGCCAGCCCGTGCACAC |
| Internal bar code: | TTTAAGACGCTACAAGGACTGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 851 |
| LEAP-Seq percent confirming: | 99.26 |
| LEAP-Seq n confirming: | 3890 |
| LEAP-Seq n nonconfirming: | 29 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTAGCGTTGCCTTCTATGCC |
| Suggested primer 2: | CAATCATCGAGTCCGGAGAT |