Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.095316 |
Chromosome: | chromosome 16 |
Location: | 4380951 |
Confidence (%): | 58 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre16.g671400 | ARS1 | (1 of 2) IPR000917//IPR012083//IPR017850 - Sulfatase // Arylsulfatase // Alkaline-phosphatase-like, core domain; Periplasmic arylsulfatase 1 | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTGAGGCATGGGGTTGAAAGCGGGGATGGG |
Internal bar code: | TAGACTGGTATCGGCCTGGCTA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 478 |
LEAP-Seq percent confirming: | 98.7423 |
LEAP-Seq n confirming: | 4318 |
LEAP-Seq n nonconfirming: | 55 |
LEAP-Seq n unique pos: | 32 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CCGTGGAAACACCCATTTAC |
Suggested primer 2: | CACTCTTCGCTCCGACTACC |