| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.095329 |
| Chromosome: | chromosome 9 |
| Location: | 5879033 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g402404 | (1 of 1) IPR002048//IPR013761 - EF-hand domain // Sterile alpha motif/pointed domain | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGGCAAACGGTGACAGACACACGTACCGTG |
| Internal bar code: | GAGGGTCCAGTGCGTGTGCCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 262 |
| LEAP-Seq percent confirming: | 97.5379 |
| LEAP-Seq n confirming: | 515 |
| LEAP-Seq n nonconfirming: | 13 |
| LEAP-Seq n unique pos: | 16 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTGCAGGCACGATCAGTTAG |
| Suggested primer 2: | CTGATGCTGCTCCTACCTCC |