| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.095356 |
| Chromosome: | chromosome 17 |
| Location: | 5395187 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g736650 | (1 of 2) K01256 - aminopeptidase N (pepN) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGTGCAAGACTGCAAGGGGAAAGTGCTAGG |
| Internal bar code: | GTGGCTCGCTTTCTACTGTGAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 85 |
| LEAP-Seq percent confirming: | 99.9437 |
| LEAP-Seq n confirming: | 1776 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGTGTGTGTGTTTGGGTGTG |
| Suggested primer 2: | GAGGCATTAATCACCCCAGA |