| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.095420 |
| Chromosome: | chromosome 16 |
| Location: | 4713138 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g687000 | FPN1 | Ferroportin 1; (1 of 1) K14685 - solute carrier family 40 (iron-regulated transporter), member 1 (SLC40A1, FPN1) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCGCGGGATGGGCCGGGTGGGATTACTAG |
| Internal bar code: | TGTCGGTACTAGGACGCAGCCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 93 |
| LEAP-Seq percent confirming: | 78.3505 |
| LEAP-Seq n confirming: | 152 |
| LEAP-Seq n nonconfirming: | 42 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGCAAGCAAGTGATACGACA |
| Suggested primer 2: | AAGGTGGTCAGGTACATCGG |