| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.095437 |
| Chromosome: | chromosome 1 |
| Location: | 59773 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g000350 | OXR1 | (1 of 1) 1.14.13.12//1.14.14.1 - Benzoate 4-monooxygenase / p-hydroxybenzoate hydroxylase // Unspecific monooxygenase / Xenobiotic monooxygenase; possible oxidoreductase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCCTACGTTGCTGACCTCACTGCGCCCTTG |
| Internal bar code: | CTCGCGCAACTAACTCAGCCTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 148 |
| LEAP-Seq percent confirming: | 86.0681 |
| LEAP-Seq n confirming: | 278 |
| LEAP-Seq n nonconfirming: | 45 |
| LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGTGTCATACTGGCCCTTGG |
| Suggested primer 2: | ACCCAAGGACTAGGCTCCAT |