| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.095497 |
| Chromosome: | chromosome 9 |
| Location: | 5723499 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g401701 | (1 of 1) IPR001104//IPR010721 - 3-oxo-5-alpha-steroid 4-dehydrogenase, C-terminal // Protein of unknown function DUF1295 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TATGCTATGCTCCCCTACCCTCCCCTTCCT |
| Internal bar code: | TTCCGCGGCGGTAGTTGCCGTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 247 |
| LEAP-Seq percent confirming: | 97.807 |
| LEAP-Seq n confirming: | 446 |
| LEAP-Seq n nonconfirming: | 10 |
| LEAP-Seq n unique pos: | 10 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCTGCCTTTGTCATCCTAGC |
| Suggested primer 2: | GGTTGTAAAAACCAAGCCGA |