Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.095639 |
Chromosome: | chromosome 11 |
Location: | 760483 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre11.g467632 | (1 of 1) IPR008979//IPR017853 - Galactose-binding domain-like // Glycoside hydrolase superfamily | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCTGGTGGCGCAGGTCTCGCCGGGCAACGC |
Internal bar code: | TGCACTTCGTAGACCGGCTTGG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 483 |
LEAP-Seq percent confirming: | 97.8814 |
LEAP-Seq n confirming: | 231 |
LEAP-Seq n nonconfirming: | 5 |
LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ACGTGAGGGAACGGTAACAG |
Suggested primer 2: | TCACTCACATCCTGTCTCGC |