| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.095703 |
| Chromosome: | chromosome 4 |
| Location: | 2141171 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre04.g219700 | BBS9 | (1 of 1) K19398 - Bardet-Biedl syndrome 9 protein (BBS9); Bardet-Biedl syndrome-9 associated protein | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCCCACACGCCCCCCACACACCCCAGGCGA |
| Internal bar code: | GCTGCATGGGCACAGCAACGGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 455 |
| LEAP-Seq percent confirming: | 63.2178 |
| LEAP-Seq n confirming: | 2499 |
| LEAP-Seq n nonconfirming: | 1454 |
| LEAP-Seq n unique pos: | 15 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAGTCTGTGACCGCACTTGT |
| Suggested primer 2: | TAGCAGCAGTAGCAAGCGAG |