| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.095720 |
| Chromosome: | chromosome 11 |
| Location: | 1542343 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre11.g467753 | HMOX2,HMO2 | Heme oxygenase; (1 of 1) PTHR10720 - HEME OXYGENASE | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTCAAGGACGTGCTCAAGGGCGGGCTGTAC |
| Internal bar code: | GAGAACGATCGTACAGGAATTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 316 |
| LEAP-Seq percent confirming: | 99.0233 |
| LEAP-Seq n confirming: | 2636 |
| LEAP-Seq n nonconfirming: | 26 |
| LEAP-Seq n unique pos: | 9 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CATTGCTCTGTTCTCCGACA |
| Suggested primer 2: | GAGAACACGTACGCAAGCAA |