| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.095917 |
| Chromosome: | chromosome 6 |
| Location: | 7501632 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g300450 | (1 of 14) IPR003593//IPR003959//IPR027417 - AAA+ ATPase domain // ATPase, AAA-type, core // P-loop containing nucleoside triphosphate hydrolase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTGAGGTGGACCGTAGTTACCACTGCTTGC |
| Internal bar code: | GTTAGGATTTGCTTTCTCTTGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1003 |
| LEAP-Seq percent confirming: | 99.6351 |
| LEAP-Seq n confirming: | 13653 |
| LEAP-Seq n nonconfirming: | 50 |
| LEAP-Seq n unique pos: | 21 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTCTTTGCACTGCTGGTCAC |
| Suggested primer 2: | GGGTGGATGGACTGACTTGT |