Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.095928 |
Chromosome: | chromosome 1 |
Location: | 1426210 |
Confidence (%): | 58 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre01.g007150 | (1 of 1) PTHR12864:SF14 - RAN-BINDING PROTEINS 9/10 HOMOLOG | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGCGACGTGTGCAGTTGTTGGGCCAGCAGG |
Internal bar code: | TTGGGACTCTTGCAATCGAAGC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 347 |
LEAP-Seq percent confirming: | 82.6367 |
LEAP-Seq n confirming: | 771 |
LEAP-Seq n nonconfirming: | 162 |
LEAP-Seq n unique pos: | 9 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AGTAACGCCTCAGTCGTCGT |
Suggested primer 2: | GCTCAGAAACTCCAACTGCC |