Insertion junction: LMJ.RY0402.096001_1

Overview

Insertion cassette:CIB1
Side of cassette:3'
Strand:+
Strain:LMJ.RY0402.096001
Chromosome:chromosome_12
Location:1215867
Confidence (%):73
Locus systematic id Locus common name Defline Orientation Feature
Cre12.g489500 sense CDS

Insertion site details

Flanking sequence (orientation from cassette outwards):TACACCGGCCAGCCCTCTCCGCGGCAGCAC
Internal bar code:ACGGCCACACGTTAAGACGCCT

Confirmation - LEAP-Seq

LEAP-Seq distance:413
LEAP-Seq percent confirming:97.0297
LEAP-Seq n confirming:588
LEAP-Seq n nonconfirming:18
LEAP-Seq n unique pos:9

Suggested primers for confirmation by PCR

Suggested primer 1:AGTCTTCAGCCATGTCGCTT
Suggested primer 2:ATGTTCCGTTCGTATAGCGG