| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.096014 |
| Chromosome: | chromosome 6 |
| Location: | 8044309 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g304300 | POA6 | 20S proteasome alpha subunit F; (1 of 1) K02725 - 20S proteasome subunit alpha 6 (PSMA1) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCCCGGTCCGTTTCCGCCTTTTATCCACC |
| Internal bar code: | CAACCCTGGGTTAACTCGAGGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 212 |
| LEAP-Seq percent confirming: | 95.6392 |
| LEAP-Seq n confirming: | 965 |
| LEAP-Seq n nonconfirming: | 44 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGCATAGGCGTCTCAAGGAA |
| Suggested primer 2: | ATCGCTTGCAGCTAACACCT |