| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.096024 |
| Chromosome: | chromosome 2 |
| Location: | 4226828 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g098750 | (1 of 7) PF00027//PF00520 - Cyclic nucleotide-binding domain (cNMP_binding) // Ion transport protein (Ion_trans) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGGCGTATCAAAACCGGCGTGCGGCTAGGG |
| Internal bar code: | CATCTTTGAAATCACGTTCGGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1 |
| LEAP-Seq percent confirming: | 89.5442 |
| LEAP-Seq n confirming: | 334 |
| LEAP-Seq n nonconfirming: | 39 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCAAACTTTGTCGTGCTTGA |
| Suggested primer 2: | ACTGCTGACCGTTTCTTGGT |