| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.096120 |
| Chromosome: | chromosome 14 |
| Location: | 3847802 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre14.g632767 | (1 of 1) K01104 - protein-tyrosine phosphatase (E3.1.3.48) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTCATGACCGCCTACTGCTCCAGGTTCAAG |
| Internal bar code: | TGACAAGTACCCTGCATGCCTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 65 |
| LEAP-Seq percent confirming: | 99.3865 |
| LEAP-Seq n confirming: | 162 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTTGGTGGTTGATAGCGGTT |
| Suggested primer 2: | CCCTTGACAGCCTCACTAGC |