| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.096192 |
| Chromosome: | chromosome 4 |
| Location: | 2693502 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre04.g223300 | CCP1 | (1 of 5) K15109 - solute carrier family 25 (mitochondrial carnitine/acylcarnitine transporter), member 20/29 (SLC25A20_29, CACT, CACL, CRC1); Low-CO2-inducible chloroplast envelope protein | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTGTTAAATGATGATTTTGACTGCTGTTTT |
| Internal bar code: | AAGGTTTACCTCGTCGGGTAGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 135 |
| LEAP-Seq percent confirming: | 69.3694 |
| LEAP-Seq n confirming: | 539 |
| LEAP-Seq n nonconfirming: | 238 |
| LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTACGAGGAGAACGTGGAGC |
| Suggested primer 2: | GTGGTCCTGAGAGGGTGTGT |