Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.096253 |
Chromosome: | chromosome 2 |
Location: | 5153063 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre02.g105350 | (1 of 2) PF03619 - Organic solute transporter Ostalpha (Solute_trans_a) | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CATCGAAATGGGCATGGACAGGATGACAAA |
Internal bar code: | GGGAGGTATCCCACCCAGCGGG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 675 |
LEAP-Seq percent confirming: | 97.771 |
LEAP-Seq n confirming: | 965 |
LEAP-Seq n nonconfirming: | 22 |
LEAP-Seq n unique pos: | 11 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GTAGGCCATGAGATAGGCGA |
Suggested primer 2: | CTGGGAGTTTCAAAAGCAGC |