Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.096312 |
Chromosome: | chromosome 11 |
Location: | 3606847 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre11.g482001 | FAP208 | Ankyrin Repeat Flagellar Associated Protein 208; (1 of 1) K13118 - protein DGCR14 (DGCR14) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCCACTCCTGGTACCCCCTGGACCATCTAG |
Internal bar code: | CTGCAGTAGGCTTTTCGATCGG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 200 |
LEAP-Seq percent confirming: | 73.5867 |
LEAP-Seq n confirming: | 1588 |
LEAP-Seq n nonconfirming: | 570 |
LEAP-Seq n unique pos: | 9 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ATGAAGGGGGTATTGGGAAG |
Suggested primer 2: | CTGCACACAACCGTAACCAC |